Introduction
Alpha-linolenic acid (ALA, n:3/omega-3) and
linoleic acid (LA, n:6/omega-6) serve as precursors for the synthesis of long
chain fatty acids such as eicosapentaenoic acid (EPA) and docosahexaenoic acid
(DHA) (Tang et al. 2018). EPA and DHA can not only promote brain development,
improve visual acuity, prolong life expectancy, but also help in eradicate
heart disease, hypertension, diabetes and cancer (Bai et al. 2016). Since the rediscovery of ancient and sacred oil crop
chia, it has become more and more attractive due to its high unsaturated fatty
acid content such as ALA and other important nutraceuticals such as proteins,
edible fiber, seed coat gel, vitamin E, and flavonoid antioxidants (Sreedhar et al. 2015). Among known crops, Chia as
an oil plant contains the highest ALA level of the total fatty acids. It is
grown in deserts below an altitude of 4,000 feet in Mexico and Southwest
America, and has developed into one of the important staple crops by ancient
Astek and Mayas (Ayerza and Coates 2005).
Plant flowering time is mainly
regulated by five pathways: photoperiod pathway, vernalization pathway,
gibberellin pathway, autonomous pathway and aging pathway. The MADS-box
transcription factor SOC1 (AGL20) is
an integrator that integrates flowering signals from multiple flowering
regulatory pathways to promote flowering (Richter et al. 2013). Functional loss in Arabidopsis thaliana SOC1
mutants or transgenic silencing of SOC1 led to late flowering.
When A. thaliana SOC1-like genes were
transformed into Citrus reticulate, flowering
time was significantly accelerated (Tan and Swain 2007). Transforming petunia SOC1-like/FBP21 into tobacco resulted in early flowering, without influence
on flower number and seed quality (Ma et
al. 2011). Surprisingly, overexpression of Gossypium
hirsutum GhSOC1-like that is
orthologous to AtAGL42/71/72 in Gerbera jamesonii did not advance the
flowering time, but interfered with floral organ development (Ruokolainen et al. 2011). Rice FDRMADS8, which is an orthologue of AtAGL14, has certain influence on floral development (Jia et al. 2000) and AtAGL14 also promotes root development in Arabidopsis (Garay-Arroyo et
al. 2013). AtAGL19 promoted early
flowering in hda9 mutants, and was inhibited in HDA9 or in LDs (Kim et al. 2013). The photoperiod pathway enhances SOC1 and promotes flowering by promoting the expression of FT and CO (Yoo et al. 2005). FT and SOC1 are affected by the change of photoperiod from the leaf to the apical meristem,
promoting the plant from vegetative to reproductive growth (Immink et al. 2012). Autonomous and
vernalization pathways inhibit the expression of flowering repressor FLC and then promote flowering. FLC delays flowering by delaying SOC1 expression in meristems by
inhibiting FT (Li et al. 2016a; Richter et al. 2019). The gibberellin pathway
becomes the main flowering pathway that affects SOC1, rather than FLC and
FT in SDs (Moon et al. 2003). In Arabidopsis,
SOC1 and SOC1-like (AGL42, AGL71, AGL72) together constitute a subgroup of the
MIKCC-type MADS-box transcription factors, and its main function is to
participate in the control of the plants flowering time. Involved in the
regulation of floral organ development, SOC1
directly controls SOC1-like to
balance these SOC1-like expression
levels (Dorca-Fornell et al. 2011),
and thus precisely controls flowering. The SOC1
subgroup have been cloned in various plants, such as barley (Papaefthimiou et al. 2012), soybean (Zhong et al. 2012), mango (Wei et al. 2016), Brassica juncea (Li et al. 2019) etc. There is no report on cloning and research of SOC1 subgroup genes in the Lamiales
order.
According to the latest Chile
climate simulation research, the suitable cultivation area of traditional
short-day chia genotypes in China is restricted to mountainous regions of
southern Yunnan and Taiwan (Cortés et al.
2017). This research group took the lead in carrying out the chia research in
China. Since 2016, it was found that sowing in spring and summer in Beibei and
Hechuan (30° N), Chongqing, China, chia bloomed in October, and a small amount
of mature seeds could be harvested in late autumn. Though a small proportion of
the seeds on the ear could mature, most seeds could not reach full maturity,
indicating that the southern part of the Sichuan Basin, which is warm and
frost-free in the winter, is a planting northern margin of traditional chia.
This means that if flowering time is promoted a little, chia can be grown not
only in China's low-latitude climate-friendly regions but also in the entire
Sichuan Basin and many other parts of China's mid-latitudes. Even for the whole
world, short-day photoperiod habit and late flowering of chia is the crucial
limiting factor for its crop spreading, thus dissecting chia flowering
mechanism has become a necessary basic work. In this study, two SOC1 genes were cloned from chia, the
basic characteristics of genes and proteins were analyzed, the plant SOC1 evolutionary characteristics were
revealed, and their transcriptional organ-specificity and responsiveness to
multiple hormones under long/short photoperiods, circadian rhythms, seasonal
transitions and abiotic stresses were also investigated. It will promote the understanding
of the chia flowering mechanism, and enrich the understanding of SOC1.
Materials and Methods
Plant materials, treatment, and nucleic acid extraction
Chia
was grown at Hechuan Farm, Southwest University, sown on May 24, 2016. On
August 21–22, September 5–6,
September 20–21 and October 5–6,
mature leaves were collected at 2:58, 5:58, 9:28, 12:58, 16:28, 19:58, 23:28 of
the day. They were used for gene cloning and to detect diurnal styles of gene
expression. Root (Ro), stem (St), young leaves (YL), mature leaves (ML), young
buds (YB, about 5 days old), semi-mature buds (SMB, about 10 days old), mature
buds (MB, about 15 days old), flowers (Fl), early-stage seeds (ES, about 10
days old), middle-stage seeds (MS, about 20 days old) and late-stage seeds (LS,
about 30 days old) were sampled for detecting organ-specificity of the cloned
genes.
The methods used to cultivate the seedlings of chia in the artificial
climate chamber referred by Xue et al.
(2017). The six-leaf stage seedlings were moved to the plant growth chamber for
treatment with 2 styles of photoperiods. The long-day treatment was 16 h-light
and 8h-dark, and the short-day treatment was 12h-day and 12-night, with
constant temperature of 30ºC and relative humidity of 56%. Each photoperiod
treatment lasted for one week. Four hormone treatments were carried out, i.e.
80 μmol L-1 kinetin (KT), 2 μmol L-1
brassinolide (BR), 200 μmol L-1 gibberellin (GA3)
and 250 μmol L-1 indole acetic acid (IAA). Each hormone
was treated for 0 d (control/CK, basal level), 1 d, 3 d and 9 d. Mature leaves
were sampled at each time point for characterization of phytohormone
responsiveness of ShSOC1-1 and ShSOC1-2.
Chia seedlings were cultured in the artificial climate chamber and
subjected to high temperature at 38ºC, low temperature at 4ºC, mechanical
wounding, 100 μmol L-1 methyl jasmonate (MeJA), 100 μmol
L-1 abscisic acid (ABA), 1 mmol L-1 salicylic acid (SA),
300 mmol L-1 sodium chloride (NaCl) and 10% polyethylene glycol 6000
(PEG6000). At 0 h, 0.5 h, 3 h, 9 h, 24 h, and 48 h time points after treatment,
mature leaf samples were taken for characterization of stress
responsiveness of cloned genes (Xue et
al. 2017).
Each study had 3 biological replicates. Samples were kept in liquid
nitrogen for transportation and stored at -80°C. Total cellular RNA was
extracted using the Biospin Plant Total RNA Extraction Kit (BioFlux, China),
and total gDNA was extracted from mature leaves using general CTAB method.
Electrophoresis and spectrophotometric detection were adopted to detect the
quality and quantity of the nucleic acids.
Cloning of the conservative
sequences of SOC1 genes from chia
In order
to clone the conserved region of chia SOC1
genes, the A. thaliana SOC1 mRNA was retrieved from NCBI
GenBank (NM_130128.4), and used as an electron probe for the in silico cloning the orthologous
sequence from chia-relative species Sesamum
indicum (sesame), Erythranthe guttatu,
Salvia pomifera and S. miltiorrhiza, since there was no chia
sequence in the GenBank. All SOC1
annotation mRNA, TSA, EST and gDNA tag sequences were downloaded and multiple
sequence alignment was performed. According to the conservative sites of SOC1 alignments, degenerate primer
combination FLSOC1C + RLSOC1C was designed (Table 1). One μg
of total RNA mixed from all organs was subjected to gDNA deletion and
reverse-transcription using the PrimeScript Reagent Kit with gDNA Eraser
(TaKaRa Dalian, China) to obtain the first-strand total cDNA. Then it was used
as a template for amplification of the conservative regions of chia SOC1 genes using conventional PCR
(Annealed at 58ºC and extended for 2 min).
Conventional electrophoresis, gel recovery, pMD19-T vector (TaKaRa Dalian,
China) recombination and Escherichia coli
DH5α transformation were performed. After PCR test for positive clones,
batches of clones corresponding to insert length polymorphism were sent to
Shanghai Lifei Information & Technology Company (China) for sequencing
using M13F/M13R primers.
5-RACE and 3-RACE of chia SOC1 genes
The results of sequencing showed
that the conservative regions of 2 chia SOC1
genes were obtained, which were named as
ShSOC1-1 and ShSOC1-2
respectively. Then 5'-RACE and 3'-RACE primers of ShSOC1-1 and ShSOC1-2
were designed (Table 1), according to the conservative
region sequences. One μg of total RNA of organ-mixture was used as
start material for RACE handling using the SMARTer™ RACE Amplification Kit
(Clontech, U.S.A.) to obtain the first-strand total cDNA template of the
5'-RACE and 3'-RACE, respectively. Primers FShSOC1-13-1/FShSOC1-23-1 and
FShSOC1-13-2/FShSOC1-23-2 were used for pairing with the universal primer LUPM
and NUP (Table 1) for 3'-RACE primary and nested amplifications of ShSOC1-1/ShSOC1-2, respectively. The PCR
annealing temperature was 63°C, and the extension time was 1 min. Primers RShSOC1-15-1/RShSOC1-25-1
and RShSOC1-15-2/RShSOC1-25-2 were matched with the universal primers LUPM and
NUP (Table 1) for primary and nested amplifications of 5'-RACE of ShSOC1-1/hSOC1-2, respectively. The PCR annealing temperature was 62°C and
the extension time was 1 min. Electrophoresis, gel recovery, TA cloning and
sequencing were performed.
Cloning of full-length sequences of chia SOC1 subfamily genes
Based on the conservative regions
and 5'-RACE and 3'-RACE results, we can obtain the full-length cDNAs of ShSOC1-1 and ShSOC1-2 using Vector NTI assemblage function. Based on this, we
designed the primer combinations FShSOC1-1
+ RShSOC1-1 and FShSOC1-2 + RShSOC1-2
(Table 1). The two full-length cDNAs were amplified by PCR using 3'-RACE
template, annealed at 55°C and extended for 2 min. Electrophoresis, gel
recovery, TA cloning and sequencing were performed.
Bioinformatics analysis
GenBank sequence search, BLAST, in silico cloning, and CDD detection
were performed at NCBI (http://www.ncbi.nlm.nih.gov). Vector NTI Advance 11.5.1
and DNAStar version 7.1.0 software were used for sequence creation, analysis,
annotation, translation, comparison, assembly and other analysis. Protein
analysis were performed at Expasy (http://www.expasy.org), GSDS2.0
(http://gsds.cbi.pku.edu.cn/), CBS (http://www.cbs.dtu.dk/ Services/).
According to the NCBI BLASTp chia SOC1 subfamily results, completed genome
sequencing and representative species in plant taxonomy were selected, and then
all their SOC1 proteins sequences were electronically cloned, and then multiple
comparisons were performed using ClustalX V2.0 to generate fst files. SeaView
4.0 uses the muscle pattern to perform multiple comparisons. Under Distance
Method and BioNJ method, Distance=Poisson and Bootstrap=1000 are set to build
the phylogenetic tree and display the tree in Squared format.
qRT-PCR detection of transcript expression of chia SOC1 genes
The transcriptional expression of ShSOC1-1 and ShSOC1-2 was detected by using FShSOC1-1RT
+ RShSOC1-1RT, FShSOC1-2RT + RShSOC1-2RT
primer pairs, respectively. The 25SrRNA
was detected by F25SRT + R25SRT as internal control (Table 1).
qRT-PCR was performed on a CFX Connect™ Real-Time PCR Detection System
(Bio-Rad, U.S.A.) with a program of 95°C for 10 min, and 45 cycles of
amplification (95°C for 10 sec, 60°C for 20 sec, 72°C for 10 sec). When qRT-PCR
was completed, the temperature was raised from 65°C to 95°C and the melting
curve was detected to confirm the specificity of the amplification.
Results
Cloning of full-length cDNAs of ShSOC1-1
and ShSOC1-2 genes
Electrophoresis analysis of PCR
product of amplification for the conservative sequences of the chia SOC1 genes showed a 0.6-kb specific
band. Sequencing of 20 positive clones produced 2 member genes and NCBI BLASTn
showed orthologs to the SOC1 (AtAGL20) and SOC1-like (AtAGL42) of plants, and they were named
as ShSOC1-1 and ShSOC1-2, respectively.
No significant band was found in the primary amplifications of 5'-RACE and
3'-RACE of ShSOC1-1 and ShSOC1-2,
with only smear at the predicted size. The 5'-RACE nested PCRs of ShSOC1-1 and ShSOC1-2 each generated a band of about 350 bp. After TA cloning,
5'-RACE clones had insert length polymorphisms. The net length of ShSOC1-1 clones after batch sequencing
was 206, 231, 418, 377 bp, with intron retention in some clones. The net length of ShSOC1-2 clones was 251, 286, 309, and
310 bp. The 3'-RACE of ShSOC1-1 and ShSOC1-2 nested PCR
generated 2 bands of about 0.35 kb and 0.45 kb, respectively. All the 3'-RACE
clones had polymorphic insert length after TA cloning. The net ShSOC1-1 clones were 298, 344, 349, and 397
bp, with a net length of 369, 430, 435, 461, and 485 bp for ShSOC1-2 (Poly A not included). Based on
the RACE
results, about 1.2 kb and 1 kb band identical to the expected size was obtained
by amplifying the full-length cDNA of ShSOC1-1
and ShSOC1-2 using end-to-end PCR
primer combinations. The sequences corresponded to the assembled ones. Sequence
analysis revealed intron retention in the 5'-RACE of some of the mRNA molecules
of ShSOCl-1, so ShSOCl-1 has 3 versions of mRNA, whereas ShSOCl-2 has only one version of mRNA. We chia total gDNA was used as template to amplify
the full-length gDNAs of ShSOC1-1 and ShSOC1-2, which was failed even we
replaced reagents such as enzymes and optimized the amplification cycle
parameters, indicating that they either have very long introns or have very complex
structures.
Structure and features of ShSOC1-1 and
ShSOC1-2 genes
Table 1: Primers used in cloning and qRT-PCR detection of SOC1 genes from Chia
Primers name |
Primers sequence (5’→3’) |
Application |
FLSOC1C |
AGAAATGGGCTGYTGAAGAARGC |
Forward primer for Chia SOC1 conservative regions amplification |
RLSOC1C |
GGBRGNCCDATGAACAATTCNGTCDCNAC |
Reverse primer for Chia SOC1 conservative regions amplification |
FShSOC1-13-1 |
TTGAGCGCAGTGTCACCACCATTCGT |
GSP for
ShSOC1-1 3'-RACE primary amplification |
FShSOC1-13-2 |
TTGGACTTCAAACACAAGGTGGAGG |
GSP for
ShSOC1-1 3’-RACE nested amplification |
FShSOC1-23-1 |
TCCAGCGAAGCCTACACAATGTCAGG |
GSP for
ShSOC1-2 3’-RACE primary amplification |
FShSOC1-23-2 |
GTGAAGTTAGGGAAACAGAAAGAGAGAG |
GSP for
ShSOC1-2 3’-RACE nested amplification |
RShSOC1-15-1 |
CTGCATATTATGCTCCGAAGGTGGATTG |
GSP for
ShSOC1-1 5'-RACE primary amplification |
RShSOC1-15-2 |
TGAGCTTGCAAATTCATGGAGCTTGCC |
GSP for
ShSOC1-1 5’-RACE nested amplification |
RShSOC1-25-1 |
CTTCATGCGTTGTTCGACTTCATTGCC |
GSP for
ShSOC1-2 5’-RACE primary amplification |
RShSOC1-25-2 |
TTGGAGCTTGAGAACTCATAAAGTCTTCC |
GSP for
ShSOC1-2 5’-RACE nested amplification |
LUPM |
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT |
Anchor primer for 5'-and 3'-RACE
primary amplification |
NUP |
AAGCAGTGGTATCAACGCAGAGT |
Anchor primer for 5'-and 3'-RACE
nested amplification |
FShSOC1-1 |
ACTGTGAATATTACTCCTAGTACTACTAC |
ShSOC1-1 full-length forward primer |
RShSOC1-1 |
AATGCATAAAAAAGTTGTCATTAGTTAATAAATA |
ShSOC1-1 full length reverse primer |
FShSOC1-2 |
CCTCCCTCTCTCTCTCTCTCTCTCACAT |
ShSOC1-2 full-length forward primer |
RShSOC1-2 |
AGATTAAAGATGCATCCAAAAGAATTTCCAG |
ShSOC1-2 full length reverse primer |
F25SRT |
GATTTCTGCCCAGTGCTCTGAA |
25SrRNA qRT-PCR forward primer |
R25SRT |
TCTGCCAAGCCCGTTCCCTT |
25SrRNA qRT-PCR reverse primer |
FShSOC1-1RT |
GGCTACTTGGTGAAGGGTTAGG |
ShSOC1-1
qRT-PCR forward primer |
RShSOC1-1RT |
CTCTCCTCGTTCGATCCTCCT |
ShSOC1-1
qRT-PCR reverse primer |
FShSOC1-2RT |
GCAATGAAGTCGAACAACGCAT |
ShSOC1-2
qRT-PCR forward primer |
RShSOC1-2RT |
CATTGTGTAGGCTTCGCTGGA |
ShSOC1-2
qRT-PCR reverse primer |
Fig. 1 shows that ShSOC1-1 has 3 versions of mRNA (GenBank
Accession Numbers MF577048, MF577049 and MF577050). The longest standard mRNA
is 1103 bp (Poly A not included), the longest mRNA of 5'-UTR intron-retention
is 1299 bp, and the longest mRNA is 1112 bp which has a 9-bp alternative
splicing at the right border of the second intron. The longest mRNA of ShSOC1-2 is 1003 bp (Poly A not
included, GenBank Accession Number MF577051). The normal 5′-UTR, ORF and 3′-UTR of ShSOC1-1/ShSOC1-2 are
196/128 bp, 666/642 bp, and 241/233 bp, respectively. The G+C content of 5′-UTR, ORF, and 3′-UTR of ShSOC1-1/ShSOC1-2 were 36.2/41.4%, 52.0/44.8% and 29.5/29.2%, respectively. There were 3
and 4 transcription initiation sites for ShSOC1-1
and ShSOC1-2, with 4 and 6 poly A
tail sites, respectively. The identity percentages between ShSOC1-1 and ShSOC1-2 on
mRNA and ORF levels were 54.1 and 58.7%, respectively. BLASTn showed that
ShSOC1-1 has higher homology with
sesame SOC1, followed by E. guttata SOC1; and ShSOC1-2 has higher homology with sesame
AGL42, followed by E. guttata SOC1-like. The phylogenetic tree of coding regions indicates that ShSOC1-1 and ShSOC1-2 are orthologous to the SOC1
and SOC1-like in the plant kingdom,
respectively.
Characterization of deduced ShSOC1-1 and ShSOC1-2 proteins
The ShSOC1-1 and ShSOC1-2
proteins are 221 aa and 213 aa in length, with theoretical MWs of 25.04 and
24.97 kD, pIs of 9.06 and 9.55, respectively, and which are alkaline. The
identity percentage between ShSOC1-1
and ShSOC1-2 is 50.2% and the
positives percentage is 61.8%. BLASTp showed that ShSOC1-1 has higher homology with E. guttata and sesame SOC1,
followed by Plantago major SOC1; ShSOC1-2 has higher homology with the sesame SOC1 and AGL42, followed
by the E. guttata SOC1.
Fig. 1: mRNA and
encoded amino acid of ShSOC1-1 and
ShSOC1-2 genes
The start codon ATG and the stop codon TGA/TAG are in underlined bold
face. Transcription start sites and polyadenylation sites are in underlined and
italic bold face. The possible polyadenylation signals are in italic bold face.
5’UTR-intron in ShSOC1-1 is labeled
with grey background. Poly A tail is in lower case
NCBI BLASTp CDD analysis showed
that ShSOC1-1 and ShSOC1-2 have MADS and Coiled coil domains. SignalP 4.1
predicted that ShSOC1-1 and ShSOC1-2 do not contain a signal peptide. BaCelLo
(http://gpcr.biocomp.unibo.it/bacello/pred.htm), EpiLoc
(http://epiloc.cs.queensu.ca/), Plant-mPLoc
(www.csbio.sjtu.edu.cn/bioinf/plant-multi/), and YLoc (www.multiloc.org/YLoc)
predicted ShSOC1-1 and ShSOC1-2 are located in the nucleus.
SLP-Local predicts that they are located to the mitochondria or nucleus. Taken
together, they are most probably located to the nucleus, consistent with the
identity of the MADS-box transcription factors. TMHMM2.0
(www.cbs.dtu.dk/services/TMHMM/) and TOPCONS (http://topcons.net/) predicted
that ShSOC1-1 and ShSOC1-2 have no
transmembrane domain. NetPhos3.1 (www.cbs.dtu.dk/services/NetPhos/) predicted
that ShSOC1-1 has 23 potential
phosphorylation sites, including 15 S (serine), 7 T (threonine), and 1 Y
(tyrosine), and ShSOC1-2 have 21
potential phosphorylation sites, with 11 S, 9 T, and 1 Y.
In the secondary structures
predicted by SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/secpred_sopma.pl),
α-helix of ShSOC1-1/ShSOC1-2 as
high as accounted for 59.73/68.08%, β-sheet (extended strand) accounted
for 7.69/14.08%, β-turn accounted for 7.24/5.16%, and random coil
accounted for 25.34/12.68% (Fig. 2). ShSOC1-1
has several large α-helix in middle sites, while ShSOC1-2 has a very large α-helix throughout the middle sites
and the α-helix occupies a large proportion in these two genes. However,
the N-terminal α-helix of ShSOC1-1
is apparent, whereas the N-terminus of ShSOC1-2
has no α-helix.
The tertiary structures of ShSOC1-1 and ShSOC1-2
were predicted by SWISS-MODEL (https://swissmodel.expasy.org), which are
similar to each other. In many flowering plants, the SOC1 genes are important flowering regulatory genes, known as the
signal integrator of flowering pathway (Chen et al. 2017). In combination with the protein structures, key sites
in the conserved region, and physicochemical properties of ShSOC1-1 and ShSOC1-2, it
was concluded that ShSOC1-1 and ShSOC1-2 genes may be involved in the
regulation of flowering traits in Chia.
Fig. 2:
Predicted secondary structures of ShSOC1-1
and ShSOC1-2
Fig. 3:
Phylogenetic relationship of SOC1
subgroup proteins from plant kingdom
Ac, Adiantum capillus-veneris; Ao, Asparagus officinalis;
At, Arabidopsis thaliana; Atr, Amborella
trichopoda; Bd, Brachypodium
distachyon; Dc, Dendrobium catenatum;
Eg, Erythranthe guttatus; Fv, Fragaria vesca; Th, Tarenaya hassleriana; Gm, Glycine
max; Mn: Monoraphidium neglectum;
Os: Oryza
sativa; Pa: Picea abies; Ps: Picea
sitchensis; Sh, Salvia hispanica;
Si, Sesamum indicum; Th: Tarenaya hassleriana; Vv, Vitis vinifera
The phylogenetic relationship of ShSOC1
proteins and SOC1 evolution in plant
kingdom
In order to systematically explore
the phylogenetic relationships of the ShSOC1
genes and reveal some new features of the evolution of the plants SOC1 subgroup in the plant kingdom, we
selected different taxa from the plant kingdom (chlorophytas,
ferns, gymnosperms, monocots, and dicots) with whole genomes being sequenced to
carry out phylogenetic analysis. Their SOC1 proteins were electronically cloned
and then ShSOC1-1 and ShSOC1-2 were used together to construct
a phylogenetic tree of SOC1 proteins (Fig. 3). The phylogenetic
relationships among the species showed by this tree conform to taxonomy
positions established by traditional community. Some new phenomena can be
observed. There is no SOC1 in
non-seed plants (green aglae, ferns, etc.).
Although there are MADS-box transcription factors in Monoraphidium neglectum and Adiantum
capillus-veneris, there is a non-orthologous relationship with SOC1. The origins of SOC1 is accompanied by the birth of
sexual reproduction through “flowering” and seed setting.
The plant SOC1 subfamily phylogenetic tree has two clusters: gymnosperms (Picea abies, Picea sitchensis) and angiosperms. The gymnosperm SOC1 cluster occupies the basal sites,
and the angiosperm SOC1 cluster is
divided into 4 branches. The monocots plant has 1 branch, and the dicots plant
have 3 branches corresponding to Arabidopsis
SOC1/AGL20, AGL42/71/72/SOC1-like,
and AGL14/19/SOC1-like respectively.
Within gymnosperms and monocots, it seems that SOC1 duplication events widely occurred at order or family levels,
resulting in 2 or more SOC1 genes in
most analyzed species. The ancestor of dicots has experienced SOC1 twice duplication events, making
the 3-SOC1-gene basic status of all
eudicots. In Brassicales, more than one families have experienced their own AGL14 and AGL42 duplications, causing the
AGL14/19 double gene and AGL42/71/72
triple gene status. At protein sequence level, AGL42 is conserved, while AGL71/72 diverged rapidly. In non-Brassicales
eudicots, there is only one gene corresponding to Brassicales AGL14/19 and AGL42/71/72 respectively. Besides Brassicales AGL71/72, soybean GmSOC1-like/XP_003536488.1
and GmSOC1-like/XP_006606087.1,
strawberry FvAGL14/XP_011463796.1, Brachypodium
distachyon BdMADS50-like/NP_001289808.1, rice OsSOC1-like/XP_015625203.1 etc. also evolved rapidly at protein
sequence level. It is noteworthy that the basal angiosperm Amborella trichopoda (common ancestor of monocots and dicots) has
only one SOC1 gene, indicating that
angiosperms SOC1 duplication events
occurred after separation from basal angiosperms, and the non-duplicated and
non-diversified status of important floral genes such as SOC1 might be associated with the primitive and simple floral
traits of basal angiosperms.
The phylogenetic tree also showed
that ShSOC1-1 and ShSOC1-2 were orthologous to A. thaliana SOC1/AGL20 and AGL42/71/72, respectively. They are
highly homologous to orthologous genes from Salvia,
S. indicum and E. guttata, followed by other dicots plants. Since the orthologous
gene corresponding to AtAGL14/19 is
common in dicots, it is speculated that this orthologous gene also exists in
chia and needs to be cloned.
Organ specificity of ShSOC1-1 and ShSOC1-2 expression
The results of qRT-PCR showed (Fig.
4) that the expression of ShSOC1-1
and ShSOC1-2 in all organs was
significantly different from each other. ShSOC1-1
was highest in stems and buds, and high or significant in mature leaves, semi-mature buds,
mature buds and flowers, but lowest in seeds. ShSOC1-2 was highest in young buds and significantly lower in other organs,
especially in seeds. According to the relative quantitative preliminary judgments, the expression of ShSOC1-1 in various organs is generally
higher than that of ShSOC1-2,
especially in stems, leaves, buds and flowers, implying that ShSOC1-1 may be more effective than ShSOC1-2 in regulating whole plant
overall functions as well as the basal role during the flowering process. ShSOC1-2 is mainly synergistically
up-regulated at the key time-point for flowering determination.
Fig. 4: Relative expression of ShSOC1-1 and ShSOC1-2 genes
in different chia organs
Ro: root;
St: stem; YL: young leaf; ML: mature leaf; YB: young bud; SMB: semi-mature bud;
MB: mature bud; Fl: flower; ES: early-stage seed; MS: middle-stage seed; LS:
late-stage seed
Circadian rhythm of ShSOC1-1 and ShSOC1-2 expression and its response to long-short photoperiod
seasonal shift
The qRT-PCR was used to examine the
circadian rhythms of ShSOC1-1 and ShSOC1-2 in mature leaves and the response to the seasonal change from
long to short photoperiod. The results showed that the expression of ShSOC1-1 and ShSOC1-2 was significantly different (Fig. 5). On August 21–22 (LD, sunny, 28–38
°C), ShSOC1-1 was lower in the
morning and did not change very much, upregulated from the afternoon and
increased significantly at night, but fluctuated slightly at midnight; ShSOC1-2 was lower throughout the day,
and there was almost no significant fluctuation. On September 5–6 (LD, rainy,
20–24°C), affected by the rainy weather, ShSOC1-1
was very low with less fluctuation within a whole day, while ShSOC1-2 was low in morning, with a peak
in afternoon, and then gradually down-regulated until maintaining a relatively
stable low level. On September 20–21 (Autumnal equinox, sunny, 20–28°C), the
two genes were very similar, with very weak and small changes during the
daytime, but increased at night, peaked at midnight, and then decreased. On
October 5–6 (SD, cloudy to overcast, 20–29°C), the two genes within a whole day
were significantly similar to those of August 21–22 and September 20–21; ShSOC1-1 was low during the daytime and
high at night, peaked at midnight, and then gradually decreased; ShSOC1-2 was relatively lower with
little change within a whole day. Taken together, ShSOC1-1 is characterized by predominant expression at nights on
sunny days but suppressed by rainy weather, while ShSOC1-2 is inhibited by high temperatures sunny days in summer,
and dominantly expressed in rainy afternoon and in midnight of autumnal equinox
(critical time for determining flowering and early floral differentiation).
Effect of phytohormones on the expression of ShSOC1-1 and ShSOC1-2
under long- and short-photoperiods
In the present study, KT, BR, GA3,
and IAA treatments were performed on 6-leaf chia seedlings under long/short-day
conditions (LD/SD) respectively, and the expression of ShSOC1-1 and ShSOC1-2 was
detected by qRT-PCR (Fig. 6). There are similarities and differences among
hormones as well as between genes and photoperiods. After BR treatment, ShSOC1-2 and ShSOC1-2 were slightly inhibited under LDs or SDs, with ShSOC1-2 being more sensitive. After KT
treatment, ShSOC1-1 and ShSOC1-2 were significantly inhibited
under SDs, with ShSOC1-2 being more
sensitive, and ShSOC1-1 restored
earlier. However, the expression trends of ShSOC1-1
and ShSOC1-2 were consistent under
LDs, firstly upregulated and then fluctuated, but ShSOC1-1 was more sensitive. After IAA treatment, ShSOC1-1 and ShSOC1-2 showed a slowly inhibition under SDs, but the two genes had the
same tendency under LDs, firstly up-regulated and then fluctuated, with ShSOC1-1 being more sensitive. After GA3
treatment, ShSOC1-1 had little effect
on under SDs but ShSOC1-2 was
significantly upregulated; however, ShSOC1-2
had little effect but ShSOC1-1 was
upregulated under LDs. Taken together, the expression of ShSOC1 was down-regulated by BR, KT, and IAA under SDs, but
upregulated by GA3, and ShSOC1-2
was more sensitive than ShSOC1-1.
Under LDs, the expression of ShSOC1
genes were down-regulated by BR and upregulated by KT, IAA and GA3,
and ShSOC1-1 was more sensitive than ShSOC1-2.
Effect of abiotic stresses on the expression of ShSOC1-1 and ShSOC1-2
The MADS-box transcription factor SOC1 subfamily genes regulate plant
growth as well as control flowering time and have important basic functions,
but reports on abiotic stresses influence on their expression are limited. We
used 5-week old chia seedlings for treatments with a variety of abiotic
stresses and examined changes in the expression of ShSOC1-1 and ShSOC1-2
based on qRT-PCR (Fig. 7). After cold treatment at 4°C, ShSOC1-1 was continuously upregulated within 48 h, while ShSOC1-2 was quickly and significantly
inhibited, then slowly restored to basal level at 48 h. After treatments with
heat stress at 38°C and NaCl, ShSOC1-1
and ShSOC1-2 showed fluctuation and a
rough down-regulation, though ShSOC1-1
was transiently upregulated at 0.5 h under high temperature and at 9 h under
NaCl. ABA quickly inhibited their expression, but the recovery was also quick. Although there
were small fluctuations in the expression of ShSOC1-1 and ShSOC1-2
after PEG treatment, the overall change was not clear. After MeJA, SA, and
mechanical injury treatments, ShSOC1-1
and ShSOC1-2 showed a wavy
up-regulation, especially when SA treatment was at 48 h, ShSOC1-1 and ShSOC1-2
were upregulated by 5–10 folds.
Fig. 5: Circadian rhythm of ShSOC1-1
and ShSOC1-2 expression, and response
to seasonal change from long to short photoperiod
Fig. 6: Influence of
phytohormones on the expression of ShSOC1-1
and ShSOC1-2 under long-photoperiod
(-L) and short-photoperiod (-S) respectively
Fig. 7: Influence of abiotic stresses on
the expression of ShSOC1-1 and ShSOC1-2
Discussion
In A. thaliana, all SOC1
subfamily genes AGL20/SOC1, AGL42, AGL71, AGL72, AGL14 and AGL19 participate in the regulation of flowering, and are
integrators of photoperiod, vernalization, gibberellin, autonomy, aging pathway
and other flowering pathway signals, which occupy a central position in
regulating flowering. SOC1 is
dominant within the subfamily, which regulates flowering time by regulating the
same family members AGL42, AGL71, AGL72, etc. (Lee et al. 2000; Moon et al. 2003; Dorca-Fornell et
al. 2011; Immink et al. 2012).
The Arabidopsis flowering suppressor
gene FLC normally inhibits expression
of SOC1 and rapidly upregulates SOC1 in short-day flc mutants (Hepworth et al.
2002; Moon et al. 2003). Functional
studies have shown that the function of the SOC1
subfamily to promote flowering is at least conserved in angiosperms. In dicots,
deletion of Arabidopsis SOC1 and SOC1-like leads to late flowering (Hepworth et al. 2002). The overexpression of cabbage BrAGL20 into Brassica napus
resulted in early floral phenotype (Hong et
al. 2013). Mangifera indica MiSOC1 was transformed into Arabidopsis, which resulted in an early
flowering stage (Wei et al. 2016). G. hirsutum GhSOC1 also promotes flowering after A. thaliana transformation, and it can regulate APETALA1/FRUITFULL-like gene GhMADS42 to regulate flower organ
morphology (Zhang et al. 2016). In
monocot plants, overexpression of rice OsSOC1
greatly advanced flowering time, OsSOC1
was transformed to Arabidopsis soc1 mutants to normalize flowering time
(Andersen et al. 2004), and RNA
interference of maize ZmSOC1 gene
postponed flowering time, while ZmSOC1 overexpression
or heterologous expression in Arabidopsis
promoted early flowering (Alter et al.
2016). Phyllostachys praecox SOC1 orthologous gene PvMADS56 was transformed to Arabidopsis and the flowering time was
also accelerated (Liu et al. 2016b). Dendrobium nobile DnAGL19 gene transformed into A.
thaliana promoted flowering through the HOS1-FT
pathway (Liu et al. 2016c).
With a few exceptions, FvSOC1 gene is an inhibitor of the
flowering time in the perennial short-day plant wild strawberry, which
regulates vegetative growth and reproductive growth respectively, through
independent pathways (Mouhu et al.
2013). Overexpression of G. hirsutum GhSOC1 in G. jamesonii does not advance the flowering time, but results in
the decline of floral organs (Ruokolainen et
al. 2011). Actinidia chinensis SOC1-like subfamily may not be involved
in controlling the flowering time, but may affect the length of dormancy (Voogd
et al. 2015). The I domain and C
domain are lost in the protein encoded by Kalanchoe
daigremontiana KdSOC1 gene, and its function is to play an important role
in the vegetative propagation of adventitious buds through the auxin signaling
pathway, and its overexpression affects plant morphology (Liu et al. 2016a).
Chia ShSOC1-1 and ShSOC1-2
encode proteins with typical SOC1
full domain features, which have also typical conserved domains and conserved
sites. Their transcripts are highest in the early stage of flower bud
differentiation. Given that higher plants
SOC1 subfamily generally regulates flowering and floral organ
differentiation, it is speculated that the ShSOC1
subfamily may be a positive regulator of chia flowering and early floral organ
differentiation.
A large number of literatures have
shown that phytohormones are involved in regulating flowering time, especially
the gibberellin signaling pathway is one of the five major pathways of
flowering induction, and the hormone pathway is intertwined with the
photoperiodic and vernalization reactions (Shi et al. 2019). Although SOC1 is one of the most important
integrators of the five major pathways of flowering induction, there are not
many reports on its response to the phytohormones. In view of this, four
phytohormones were sprayed on chia plants under LDs and SDs in the present
study. The results showed that under SDs ShSOC1
subfamily was down-regulated by BR, KT and IAA, but upregulated by GA3.
ShSOC1-2 was more sensitive than ShSOC1-1. ShSOC1 subfamily was down-regulated under LDs, while ShSOC1-1 was up-regulated by KT, IAA,
and GA3. ShSOC1-1 was more
sensitive than ShSOC1-2. Arabidopsis SOC1 was slowly up-regulated after GA3 treatment under
both SDs and LDs (Moon et al. 2003),
which is consistent with the trend in chia of this study. However, wheat SOC1 and SOC1-like are down-regulated when treated with GA3 under
SDs (Pearce et al. 2013), which is
contrary to the trend in chia of this study. It seems that low-temperature
long-day plants and low-temperature short-day plants remain the same, and it is
the opposite of high-temperature long-day plants. This study systematically
revealed the response expression characteristics of chia SOC1 subfamily to four phytohormones under LDs and SDs.
This study showed that, in short-day
plant chia, ShSOC1-1 and ShSOC1-2 are very different from each
other in response to circadian rhythm and seasonal transition of the long-short
photoperiod during the summer to autumn. ShSOC1-1
is characterized by predominant expression at nights on sunny days but
suppressed by rainy weather, while ShSOC1-2
is inhibited by high temperatures sunny days in summer, and is dominantly
expressed in rainy afternoon and in midnight of autumnal equinox (critical time
for determining flowering and early floral differentiation). In SDs, short-day
plant soybean SOC1 and SOC1-like family genes were low during
the daytime, high at night, peaked at midnight, and then decreased, with
soybean SOC1 consistent with chia SOC1 genes while SOC1-like largely different from chia SOC1 genes. In LDs, soybean SOC1
and SOC1-like are dynamic and stable,
with SOC1-like being similar to chia SOC1 genes while SOC1 being totally different from the chia SOC1 trend of low-in-daytime and high-at-night (Na et al. 2013). Short-day plant Zea mays ZmMADS1 as a homologue of
A. thaliana SOC1, was low during the daytime and high at night (Alter et al. 2016), which consistent with chia
SOC1, regardless of LDs or SDs.
At 37°C heat treatment, the
expression of ShSOC1-1 was firstly
rapidly upregulated, but then it was greatly inhibited, while ShSOC1-2 was immediately down-regulated
and was successively inhibited. A.
thaliana SOC1 in long-day heat
treatment was down-regulated, which was similar to chia (Takato et al. 2013). At 4°C cold treatment, ShSOC1-1 was continuously upregulated, while
ShSOC1-2 was rapidly down-regulated,
then increased continuously, and returned to basal level at 48 h, consistent
with the trend of sustained up-regulation of Arabidopsis SOC1 at 4°C cold treatment under LDs (Li et al. 2017). After PEG treatment, ShSOC1-1 and ShSOC1-2 had no major change and remained stable. After ABA and
NaCl treatments, ShSOC1-1 and ShSOC1-2 were firstly down-regulated and
even fluctuated in midway, but returned to near basal levels by 48 h, which was
slightly different from that of Arabidopsis.
SOC1 was promoted in low and medium
concentrations of NaCl, and inhibited in high concentrations of NaCl under LDs
(Liu et al. 2013). After treatments
with MeJA, SA, and mechanical injury, ShSOC1-1
and ShSOC1-2 was upregulated,
especially when SA treatment was performed for 48 h, ShSOC1-1 and ShSOC1-2 was
upregulated by 5–10 folds. This shows that SOC1
is an integrator gene that responds to the photoperiod, vernalization,
autonomous, and gibberellin pathway, and its expression characteristics have
certain fluctuations in the adverse conditions. ShSOC1-1 is continuously upregulated in response to cold treatment,
suggesting that it may also be affected by vernalization pathway. Inhibition of
flowering genes are inhibited under low temperature conditions, thereby
promoting expression of SOC1 (Amasino
2005).
In this study, representative
species with genome being completely sequenced in a typical taxonomic unit were
selected (while a few representative species did not have genome sequencing,
but the SOC1 subfamily was cloned),
and the phylogenetic tree of SOC1 proteins in the plant kingdom was
constructed. The phylogenetic trees using the SOC1 proteins are in good
agreement with the established plant community classifications in the academic
community (Li et al. 2012; Zhong et al. 2012; Zhang et al. 2018). It also reveals some new features of SOC1 gene evolution in the plant
kingdom. There is no SOC1 in non-seed
plants (green aglae, moss, ferns, etc.),
and all seed plants (gymnosperms, angiosperms) have SOC1. Because the angiosperms have a true floral structure, the
“flowers” of gymnosperms are only spore-containers instead of a true flower
structure, so the SOC1 gene origin
exactly accompanied with the origin of seed reproduction, and its function is
to initiate sexual reproductive growth (strobile/flower differentiation) in
gymnosperms and angiosperms in response to the best seasonal conditions, and
creates conditions for follow-up reproductive behavior (strobile/flower
opening, pollination, fertilization, and seed setting). Gymnosperm Cryptomeria japonica SOC1-like gene CjMADS15 and AGL6-like
gene CjMADS14 regulate the
development of male and female strobili (Katahata et al. 2014). Barley research also suggests that SOC1 subfamily genes not only respond to
vernalization and regulate flowering but also participate in regulating seed
development (Papaefthimiou et al.
2012). The plants SOC1 phylogenetic
tree have two clusters: gymnosperms and angiosperms. The gymnosperm SOC1 cluster occupies the basal site
(Zhong et al. 2012), and the
angiosperm SOC1 cluster is divided
into 4 branches. The monocots have 1 branch and the dicots have 3 branches
corresponding to Arabidopsis SOC1/AGL20, AGL42/71/72/SOC1-like, and AGL14/19/SOC1-like,
respectively. Within gymnosperms and monocots, it seems that SOC1 duplication events widely occurred
at order or family levels, resulting in 2 or more SOC1 genes in most analyzed species. The ancestors of dicots have
twice SOC1 duplication events, making
the 3-SOC1-gene basic status of all
eudicots. The AGL14/19 and AGL42/71/72 duplication phenomena
occurred in more than one families in the Brassicales order. However, only one
orthologous gene corresponds to AGL14/19
and AGL42/71/72, respectively, in
non-Brassicales dicots. AGL71/72
originated from AGL42 duplication. At
protein sequence level, AGL42 is conserved, while AGL71/72 diverged rapidly. It
is noteworthy that the basal angiosperm Amborella
trichopoda (common ancestor of monocots and dicots) has only one SOC1 gene, indicating that angiosperms SOC1 duplication events occurred after
separation from basal angiosperms, and the non-duplicated and non-diversified
status of important floral genes such as SOC1
might be associated with the primitive and simple floral traits of basal
angiosperms. The phylogenetic tree also showed that ShSOC1-1 and ShSOC1-2
were orthologous to A. thaliana SOC1/AGL20 and AGL42/71/72, respectively. Since the orthologous gene corresponding
to AtAGL14/19 is common in dicots, it
is speculated that this orthologous gene also exists in chia and needs to be
cloned.
Two duplication events of SOC1 in early dicots resulted in three SOC1 genes in eudicots, and functional
divergence occurred, e.g. some paralogs were also involved in regulating
other traits besides flowering time. Arabidopsis
SOC1 subfamily controls flowering via regulating the expression of genes
from the same family, i.e. AGL42,
AGL71, AGL72 etc. (Dorca-Fornell et al. 2011), regulates leaf stomata
opening, and prevents dark-induced chlorosis and senescence in leaves (Chen et al. 2017). AGL14 regulates auxin polarity transport and root growth in
addition to flowering (Garay-Arroyo et
al. 2013). The 3 P. hybrida SOC1-like genes regulate flowering
redundantly, but FBP21 and UNS are related to developmental age,
whereas FBP28 is more related to
short-day flowering habits (Preston et
al. 2014). All of the 3 Prunus mume
SOC1-like genes promoted flowering in
transgenic Arabidopsis, but PmSOC1-1 and PmSOC1-2 also changed flower morphology, while PmSOC1-3 did not (Li et al.
2016b). Daucus carota DcSOC1-1 was related to early bolting
and flowering with significant variations among different materials, while DcSOC1-2 expression was low. In
perennial short-day wild strawberry, FvSOC1
regulates both vegetative and reproductive growth (Mouhu et al. 2013). The daily expression rhythm of ParSOC1 in leaves of perennial trees P. armeniaca is related to cold demand and dormancy disruption
(Trainin et al. 2013). P. mume SOC1 interacts with DAM6 to
regulate both vegetative and floral bud differentiation (Kitamura et al. 2016). Divergence of expression
patterns between ShSOC1-1 and ShSOC1-2 is similar to those observed in
wild strawberry (Mouhu et al. 2013),
Orchid Dendrobium (Ding et al. 2013) and P. praecox (Liu et al.
2016b). ShSOC1-1 expression is high
in stems and buds, considerable in mature leaves, semi-mature buds, mature buds
and flowers, and low in seeds. ShSOC1-2
expression is high only in young buds, but low in all other organs especially
in seeds. Expression of ShSOC1-1 in
various organs is generally higher than that of ShSOC1-2, implying that ShSOC1-1
is more important than ShSOC1-2 in
regulating whole-plant functions and plays a basic role in determining
flowering. ShSOC1-2 is sharply
up-regulated in early stage of bud formation, which might play a decisive role
as the "last straw" in flowering time, i.e. elevating the
cellular SOC1 level above a threshold
in order to initiate flower bud differentiation.
Conclusion
In
this study two SOC1 genes, ShSOC1-1
and ShSOC1-2,
from chia were isolated and characterized. They had typical structural,
molecular and expressional features, while distinct organ-specificity and
responses to diverse physiological and environmental factors indicated their
functional divergence. The effect of phytohormones on chia SOC1 expression varied depending on the
photoperiod. Chia SOC1
expression also changed in response to circadian rhythms, climate and seasons,
and was affected by a variety of abiotic stresses. This study also revealed
some new evolutionary features, especially the origin and duplication, of
plant-type SOC1
genes. This study is the first report of SOC1
subfamily genes of the order Lamiales. It will promote the flowering mechanism
dissection of Lamiales, and also enrich the evolution and expression
characteristics of plant SOC1. Our
results will promote the study photoperiodic influence on flowering from the
interaction between the photoperiod and the hormone pathways, and shed light on
the molecular basis of flowering induction pathways in Chia and other short-day
plants.
Acknowledgements
This study was supported
by the Chongqing Research Program of Basic Research and Frontier Technology
(cstc2015jcyjBX0143), National Key R&D Program of China (2016YFD0100506)
and the Fundamental Research Funds for the Central Universities (No. XDJK2014D009).
References
Alter P, S Bircheneder, LZ Zhou, U
Schlüter, M Gahrtz, U Sonnewald, T Dresselhaus (2016). Flowering time regulated
genes in maize include the transcription factor ZmMADS1. Plant Physiol 172:389‒404
Amasino RM (2005). Vernalization
and flowering time. Curr Opin Biotechnol
16:154‒158
Andersen CH, CS Jensen, K Petersen (2004).
Similar genetic switch systems might integrate the floral inductive pathways in
dicots and monocots. Trends Plant Sci
9:105‒107
Ayerza R, W. Coates (2005). Chia: Rediscovering a Forgotten Crop of
the Aztecs, pp: 1‒197. The
University of Arizona Press, Tucson, Arizona, USA
Bai S, JG Wallis,
P Denolf, J Browse (2016). Directed evolution increases desaturation of a
cyanobacterial fatty acid desaturase in eukaryotic expression systems. Biotechnol Bioeng 113:1522‒1530
Chen J, X Zhu, J Ren, K Qiu, Z Li,
Z Xie, J Gao, X Zhou, B Kuai (2017). Suppressor
of Overexpression of CO 1 negatively regulates dark-induced leaf degreening
and senescence by directly repressing pheophytinase and other
senescence-associated genes in Arabidopsis.
Plant Physiol 173:1881‒1891
Cortés D, HS Robledo, C Baginsky, L
Morales-Salinas (2017). Climatic zoning of chia (Salvia hispanica L.) in Chile using a species distribution model. Span J Agric Res 15; Article e0302
Ding L, Y Wang, H Yu (2013).
Overexpression of DOSOC1, an ortholog
of Arabidopsis SOC1, promotes flowering in the orchid Dendrobium Chao Parya Smile.
Plant Cell Physiol 54:595‒608
Dorca-Fornell C, V Gregis, V
Grandi, G Coupland, L Colombo, MM Kater (2011). The Arabidopsis SOC1-like
genes AGL42, AGL71 and AGL72 promote
flowering in the shoot apical and axillary meristems. Plant J 67:1006‒1017
Garay-Arroyo A, E Ortiz-Moreno, MDLP
Sánchez, AS Murphy, B García-Ponce, N Marsch-Martínez, SD Folter, A
Corvera-Poiré, F Jaimes-Miranda, MA Pacheco-Escobedo, JG Dubrovsky, S Pelaz, ER
Álvarez-Buylla (2013). The MADS transcription factor XAL2/AGL14 modulates auxin transport during Arabidopsis root development by regulating PIN expression. EMBO J
32:2884‒2895
Hepworth SR, F Valverde, D
Ravenscroft, A Mouradov, G Coupland (2002). Antagonistic regulation of
flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. EMBO J 21:4327‒4337
Hong JK, SY Kim, KS Kim, SJ Kwon,
JS Kim, AK Jin, SI Lee, YH Lee (2013). Overexpression of a Brassica rapa MADS-box gene, BrAGL20,
induces early flowering time phenotypes in Brassica
napus. Plant Biotechnol Rep 7:231‒237
Immink RGH, D Posé, S Ferrario, F
Ott, K Kaufmann, FL Valentim, SD Folter, FVD Wal, ADJV Dijk, M Schmid, GC
Angenent (2012). Characterization of SOC1’s
central role in flowering by the identification of its upstream and downstream
regulators. Plant Physiol 160:433‒449
Jia HW, D Luo, B Cong, ZZ Gao, JY
Shao, KM Cao, CR Sun (2000). Cloning and expression of a new MADS-box gene from
rice. Acta Bot Sin 42:490‒495
Katahata SI, N Futamura, T Igasaki, K
Shinohara (2014). Functional analysis of SOC1-like
and AGL6-like MADS-box genes of the
gymnosperm Cryptomeria japonica. Tree Genet Genomics 10:317‒327
Kim W, D Latrasse, C Servet, DX
Zhou (2013). Arabidopsis histone
deacetylase HDA9 regulates flowering
time through repression of AGL19. Biochem Biophys Res Commun 432:394‒398
Kitamura Y, T Takeuchi, H Yamane, R
Tao (2016). Simultaneous down-regulation of DORMANCY-ASSOCIATED
MADS-BOX6 and SOC1 during
dormancy release in japanese apricot (Prunus
mume) flower buds. J Hortic Sci
Biotechnol 91:476‒482
Lee H, SS Suh, E Park, E Cho, JH
Ahn, SG Kim, JS Lee, YM Kwon, I Lee (2000). The AGAMOUS-like 20 MADS domain
protein integrates floral inductive pathways in Arabidopsis. Gene Dev
14:2366‒2376
Li C, H Gu, W Jiang, C Zou, D Wei, Z Wang, Q
Tang (2019). Protein interactions of SOC1 with SVP are regulated by a few
crucial amino acids in flowering pathways of Brassica juncea. Acta Physiol Plantarum 41:43
Li H, K Ye, Y Shi, J Cheng, X Zhang,
S Yang (2017). BZR1 positively regulates freezing tolerance via CBF-dependent and CBF-independent
pathways in Arabidopsis. Mol Plant 10:545‒559
Li W, X Liu, Y Lu (2016a).
Transcriptome comparison reveals key candidate genes in response to
vernalization of Oriental lily. BMC Genomics 17; Article 664
Li Y, Z Xu, W Yang, T Cheng, J
Wang, Q Zhang (2016b). Isolation and functional characterization of SOC1-like genes in Prunus mume. J Amer Soc
Hortic Sci 141:315‒326
Li ZN, JG Zhang, GF Liu, XM Li, C
Lu, JW Zhang, MZ Bao (2012). Phylogenetic and evolutionary analysis of A-, B-,
C- and E-Class MADS-box genes in the basal eudicot Platanus acerifolia. J Plant
Res 125:381‒393
Liu C, C Zhu, HM Zeng (2016a). Key KdSOC1 gene expression profiles during
plantlet morphogenesis under hormone, photoperiod, and drought treatments. Genet Mol Res 15:1–24
Liu SN, TT Qi, JJ Ma, TF Ma, LY Ma,
XC Lin (2016b). Ectopic expression of a SOC1
homolog from Phyllostachys violascens
alters flowering time and identity of floral organs in Arabidopsis thaliana. Trees
30:2203‒2215
Liu T, Y Li, J Ren, Y Qian, X Yang,
W Duan, X Hou (2013). Nitrate or NaCl regulates floral induction in Arabidopsis thaliana. Biologia 68:215‒222
Liu XR, T Pan, WQ Liang, L Gao, XJ
Wang, HQ Li, S Liang (2016c). Overexpression of an orchid (Dendrobium nobile) SOC1/TM3-like
ortholog, Dnagl19, in Arabidopsis regulates HOS1-FT expression. Front Plant Sci 7; Article 00099
Ma G, G Ning, W Zhang, J Zhan, H Lv,
M Bao (2011). Overexpression of Petunia
SOC1-like gene FBP21 in tobacco promotes flowering without decreasing flower or
fruit quantity. Plant Mol Biol Rep
29:573‒581
Moon J, SS Suh, H Lee, KR Choi, CB
Hong, NC Paek, SG Kim, I Lee (2003). The SOC1
MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. Plant J 35:613‒623
Mouhu K, T Kurokura, EA Koskela, VA
Albert, P Elomaa, T Hytönen (2013). The
Fragaria vesca homolog of SUPPRESSOR
OF OVEREXPRESSION OF CONSTANS1 represses flowering and promotes vegetative
growth. Plant Cell 25:3296‒3310
Na X, B Jian, W Yao, C Wu, W Hou, B
Jiang, Y Bi, T Han (2013). Cloning and functional analysis of the flowering
gene GmSOC1-like, a putative SUPPRESSOR OF OVEREXPRESSION CO1/AGAMOUS-like 20 (SOC1/AGL20)
ortholog in soybean. Plant Cell Rep
32:1219‒1229
Papaefthimiou D, A Kapazogloua, AS
Tsaftaris (2012). Cloning and characterization of SOC1 homologs in barley (Hordeum
vulgare) and their expression during seed development and in response to
vernalization. Physiol Plantarum
146:71‒85
Pearce S, LS Vanzetti, J Dubcovsky (2013). Exogenous gibberellins induce
wheat spike development under short days only in the presence of VERNALIZATION1. Plant Physiol 163:1–13
Preston JC, SA Jorgensen, SG Jha (2014).
Functional characterization of duplicated SUPPRESSOR
OF OVEREXPRESSION OF CONSTANS 1-Like genes in Petunia. PLoS One 9;
Article e96108
Richter R, A Kinoshita, C Vincent,
R Martinez-Gallegos, H Gao, ADV Driel, Y Hyun, JL Mateos, G Coupland (2019).
Floral regulators FLC and SOC1 directly regulate expression of
the B3-type transcription factor TARGET OF FLC AND SVP 1 at the Arabidopsis
shoot apex via antagonistic chromatin modifications. PLoS Genet 15;
Article e1008065
Richter R, E Bastakis, C
Schwechheimer (2013). Cross-repressive interactions between SOC1 and the Gatas GNC and GNL/CGA1 in
the control of greening, cold tolerance, and flowering time in Arabidopsis. Plant Physiol 162:1992‒2004
Ruokolainen S, YP Ng, VA Albert, P
Elomaa, TH Teeri (2011). Over-expression of the Gerbera hybrida At-SOC1-like1
gene Gh-SOC1 leads to floral organ
identity deterioration. Ann Bot
107:1491‒1499
Shi C, L Zhao, X Zhang, G Lv, Y Pan, F Chen
(2019). Gene regulatory network and abundant genetic variation play critical
roles in heading stage of polyploidy wheat. BMC Plant Biol 19; Article 6
Sreedhar RV, P Kumari, SD Rupwate,
R Rajasekharan, M Srinivasan (2015). Exploring triacylglycerol biosynthetic
pathway in developing seeds of chia (Salvia
hispanica L.): A transcriptomic approach. PLoS One 10; Article 0123580
Takato H, M
Shimidzu, Y Ashizawa, H Takei, S Suzuki (2013). An acyl-CoA-binding protein
from grape that is induced through ER stress confers morphological changes and
disease resistance in Arabidopsis. J Plant Physiol 170:591‒600
Tan FC, SM Swain (2007). Functional
characterization of AP3, SOC1 and WUS homologues from citrus (Citrus sinensis). Physiol Plantarum 131:481‒495
Tang Y, Y Jiang, J Meng, J Tao (2018).
A brief review of physiological roles, plant resources, synthesis, purification
and oxidative stability of Alpha-linolenic Acid. Emir J Food Agric 30:341‒356
Trainin T, I Bar-Ya’Akov, D Holland
(2013). ParSOC1, a MADS-box gene
closely related to Arabidopsis AGL20/SOC1,
is expressed in apricot leaves in a diurnal manner and is linked with chilling
requirements for dormancy break. Tree
Genet Genomics 9:753‒766
Voogd C, T Wang, E Varkonyi-Gasic (2015).
Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the
transition to flowering but may affect the duration of dormancy. J Exp Bot 66:4699‒4710
Wei JY, DB Liu, GY Liu, J Tang, YY
Chen (2016). Molecular cloning, characterization, and expression of Misoc1: A homolog of the flowering gene
SUPPRESSOR OF OVEREXPRESSION OF CONSTANS
1 from mango (Mangifera indica
L). Front Plant Sci 7; Article 1758
Xue YF, N Yin, B Chen, F Liao, AN
Win, J Jiang, R Wang, X Jin, N Lin, Y Chai (2017). Molecular cloning and
expression analysis of two FAD2 genes
from chia (Salvia hispanica). Acta Physiol Plantarum 39; Article 95
Yoo SK, KS Chung, J Kim, JH Lee, SM
Hong, SJ Yoo, SY Yoo, JS Lee, JH Ahn (2005). CONSTANS activates SUPPRESSOR
OF OVEREXPRESSION OF CONSTANS 1 through FLOWERING
LOCUS T to promote flowering in Arabidopsis.
Plant Physiol 139:770‒778
Zhang X, J Wei, S Fan, M Song, C
Pang, H Wei, C Wang, S Yu (2016). Functional characterization of GhSOC1 and GhMADS42 homologs from upland cotton (Gossypium hirsutum L.). Plant
Sci 242:178‒186
Zhang Y, D Tang, X Lin, M Ding, Z Tong (2018).
Genome-wide identification of MADS-box family genes in moso bamboo (Phyllostachys
edulis) and a functional analysis of PeMADS5 in flowering. BMC
Plant Biol 18; Article 176
Zhong X, X Dai, J Xv, H Wu, B Liu,
H Li (2012). Cloning and expression analysis of Gmgal1, SOC1 homolog gene
in soybean. Mol Biol Rep 39:6967‒6974